Mouse Strain information
APB ID 3685
Added 26/08/2008
Last Edited 10/05/2014
Strain name: C57BL/6JAnu-Ptprcstrm/AnuApb
Nickname: Storm ; ENU9B6:023a
Strain designation name: C57BL/6JAnu-Ptprcstrm/AnuApb
Strain Types Mutant strain
Genetic Details Chemically induced : ENU
Mode of Inheritance Recessive
1.  Affected Gene Name: protein tyrosine phosphatase, receptor type, C  
Chromosome 1
Affected Gene Symbol Ptprc
Protein expression of altered gene: Unknown
Genetic alteration of gene: ENU-induced mutation. Sequence: GAATGGGACTGCTGAGAAG[T/C]GCAATTTTCACACAAAAGCA
Location on chromosome (bp): 139959992-140071843 bp, - strand (From NCBI annotation of NCBI Build 37)
MGI Gene Accession ID

Please also use this link to determine if other mutants have been registered with MGI (Mouse Genome Informatics)

Synonyms B220, CD45, Cd45, Ly-5, Lyt-4, T200
Allele Name storm
Allele Symbol Ptprcstrm
MGI Allele Accession ID MGI:4819159
Ensembl Gene ID: ENSMUSG00000026395
Transcript ID: ENSMUST00000027645
Transcript name: Ptprc-201
bp change: T to C at position 1491 on cDNA
Exon number: 13
Exon ID: ENSMUSE00000595908
cDNA position: 1491
Amino acid change: Cysteine to Arginine at position 465
Version: NCBI m37, Ensembl build 56
Mutant Construction Technique None
Phenotype Homozygous State Low B and T cell numbers
Original Genetic Background C57BL/6JAnu
Genetic Background Currently Maintained C57BL/6JAnu
Strain Images
FACS plot from affected (#6, 7, 9) animals compared to unaffected siblings
FACS plot from affected (#6, 7, 9) animals compared to unaffected siblings
Strain identification
How is this strain characterised? Genotyping
PCR protocols Storm (amplifluor)
Fertility and Strain maintenance
Fertility and Strain maintenance
Relevant bibliographic / database references
General information
Associated IP rights? No
Does it Model a Human Condition? Unknown
Applicable Research Areas Immunology and inflammation
  • T cell
  • B cell
  • signal transduction
  • receptor
  • ENU
  • NIH
  • Wellcome Trust
  • Phosphorylation
Is the strain available in any form to other researchers Yes
APB stock stored as: Cryopreserved sperm (from 10 mice)

APB stock genotyped verified by: The APF
Are live mice available? No
MTA needs to be signed? Yes



Build: 2018.05.14 Non-profit supported by the Australian government  |  © Copyright 2018 Australian Phenomics Facility Last updated: 18/05/2018