Mouse Strain information
APB ID 1635
Added 17/07/2007
Last Edited 11/05/2014
Strain name: 129/Sv-Itsn1tm2.1Mapr/Apb
Nickname: Itsn1-L knockout
Strain designation name: 129/Sv-Itsn1tm2.1Mapr/Apb
Genetics
Strain Types Mutant strain
Genetic Details Targeted knockout
ES Cell-Line Used TC1 (129SvJ)
Mode of Inheritance Recessive
1.  Affected Gene Name: intersectin 1 (SH3 domain protein 1A)  
Chromosome 16
Affected Gene Symbol Itsn1
Protein expression of altered gene: Reduced
Genetic alteration of gene: A neo cassette with a 5' loxP site was inserted upstream of exon 32 and an additional loxP site was inserted downstream of exon 32. Transient cre expression in ES cells was used to removed the neo cassette and exon 32 causing a frame shift and premature termination of translation. The absence of the long form of the protein was confirmed by western blot analysis on brain and heart extracts.
Location on chromosome (bp): 91729526-91920842 bp, + strand (From VEGA annotation of NCBI Build 37)
MGI Gene Accession ID

Please also use this link to determine if other mutants have been registered with MGI (Mouse Genome Informatics)

MGI:1338069
Synonyms Eh domain, SH3 domain regulator of endocytosis 1, EHSH1, Ese1, Intersectin-L, Sh3p17
Allele Name intersectin 1 (SH3 domain protein 1A); targeted mutation 2.1, Melanie A Pritchard
Allele Symbol Itsn1tm2.1Mapr
MGI Allele Accession ID MGI:3812035
Allele synonyms: Itsn1-LK-
Mutant Construction Technique CRE recombinase-loxP technology
Phenotype
Phenotype Homozygous State Some homozygotes are runty after birth compared to the wildtype and die before weaning age. Otherwise they can catch up with the wildtype
Phenotype Heterozygous State No overt phenotype
Original Genetic Background 129Sv
Genetic Background Currently Maintained 129Sv
Coat Colour Agouti
Eye Colour Black
Strain identification
How is this strain characterised? Genotyping
Fertility and Strain maintenance
Fertility and Strain maintenance
Relevant bibliographic / database references
Strain Specific References
Other Related References
General information
Associated IP rights? No
Does it Model a Human Condition? Yes
Description of human condition: Alzheimer’s disease and Down syndrome
Research value of this Strain Alzheimer’s disease and Down syndrome – Itsn1 has been shown to be involved in the endocytic pathway, which appears to play a key role in the development of AD-like pathologies in AD and DS subjects
Applicable Research Areas Models for human disease
Neurobiology
Cell biology
Keywords
  • Alzheimer's disease
  • Down Syndrome
  • endocytosis
  • endosome
  • neuron
Additional Information 5’ – CTGACGTTGGGAAATACGATGAGA 3’ – GATGTCGCCAATCATCTTCACCG 3’ – GATAGACTCTAACCTGTAAGCCAG
Is the strain available in any form to other researchers Yes
APB stock stored as: Cryopreserved sperm (from 4 mice)

APB stock genotyped verified by: Unverified
Are live mice available? No
MTA needs to be signed? Yes


   

 


Build: 2017.11.14 Non-profit supported by the Australian government  |  © Copyright 2017 Australian Phenomics Facility Last updated: 16/11/2017