PCR: Ly5a/b (amplifluor)
Export PDF
ID:  293
Amplifluor: Yes
If you require further assistance regarding this PCR protocol, please contact us at genotyping.support@apf.edu.au
Primers:
Nucleotide sequence (5´ ⇒ 3´)
Primer name Sequence
Ly5a/b-1 GAAGGTCGGAGTCAACGGATTTCTTGGCCTGAGCCTGC
Ly5a/b-2 GAAGGTGACCAAGTTCATGCTTCTCTTGGCCTGAGCCTGT
Ly5a/b-R GCATAAAACATATCCATGGGGTTTAGA
Reagents:
Reagents / Constituents Commercial name Stock
Concentration
20x Primer mix
concentration (μM)
Volume (μL)
DNA Sample NA ng/μl 1.0
10x Buffer 10x Reaction Mix S Plus NA mM MgCl2 1.0
dNTPs 2.5 mM 0.8
20x amplifluor SNP FAM Primer NA μM NA
20x amplifluor SNP JOE Primer NA μM NA
Primer:  Ly5a/b-1 NA μM 0.5
Primer:  Ly5a/b-2 NA μM 0.5
Primer:  Ly5a/b-R NA μM 7.5
Amplifluor Primer Volume 1.5
Water 4.6
Taq Polyermase Platinum Taq (5U/µl) 0.1
Comments on protocol: DNA Sample (cleaned ear punch in dH20-see cleanup protocol). Reactions to be done at room temperature with reagents added in order.
Strategy:
Steps Temp (°C ) Time (seconds)
Hot start: true    
Initiation/Melting 94.0 240
Denaturation 94.0 10
Annealing 60.0 20
Elongation 72.0 40
Number of cycles
(repeat denature, anneal & elongate):
35
   
Strand completion (i.e. 72°C, 10 min) 72.0 180
Finish (i.e. 4°C, indefinite) 10.0 Hold
Electrophoresis:
Picture
Build: 2018.08.16 Non-profit supported by the Australian government  |  © Copyright 2018 Australian Phenomics Facility Last updated: 16/11/2018