PCR: Nessy typing protocol
Export PDF
ID:  464
Amplifluor: No
Primers:
Nucleotide sequence (5´ ⇒ 3´)
Primer name Sequence
Forward CCGCTAACCACCTAGAAACTTAGTC
Reverse AAACGGAAATAATGTACTTGTTGGA
Reagents:
Reagents / Constituents Commercial name Stock
Concentration
Volume (μL)
DNA Sample NA ng/μl 1.0
10x Buffer 10x pfx buffer NA mM MgCl2 1.5
dNTPs 10.0 mM 0.6
20x amplifluor SNP FAM Primer NA μM NA
20x amplifluor SNP JOE Primer NA μM NA
Primer:  Forward NA μM 0.15
Primer:  Reverse NA μM 0.15
Amplifluor Primer Volume NA
Water 11.15
Taq Polyermase 2.5U/µl Platinum Pfx Taq 0.15
50mM MgSO4 0.3
Comments on protocol: Amplify region around the mutation. Cut with the enzyme BccI, which cuts the WT sequence but not the nessy sequence. We find that invitrogen platinum Pfx taq gives excellent amplification, and is compatible with the subsequent cutting reaction. We use excess primers and dNTPs. Typing is routinely done using a crude proteinase K ear lysis. We have used other primer sequences successfully, so primers can be modified. Please note that kleisin b has two very similar pseudogenes on chromosome 15. These need to be considered when designing primers. This is the major reason we have not used ms PCR.
Strategy:
Steps Temp (°C ) Time (seconds)
Hot start: false    
Initiation/Melting 95.0 180
Denaturation 95.0 30
Annealing 55.0 30
Elongation 68.0 60
Number of cycles
(repeat denature, anneal & elongate):
40
   
Strand completion (i.e. 72°C, 10 min) 68.0 600
Finish (i.e. 4°C, indefinite) NA
Restriction Digest:
Enzyme name: BccI
Concentration: NA units/μl
Company:
Pcr volume: NA μl
Enzyme volume: NA μl
Buffer volume: NA μl
Water volume: NA μl
Temperature: 37.0 °C
Time: 600.0 mins
Comments: PCR product: 2.5µl; NEB buffer I: 2.5µl; 100x BSA: 0.25µl; BccI enzyme (NEB): 0.5µl; Water: 19.25µl.
Electrophoresis:
% Agarose 1.5
Number Band (bp) Genotype
1. 300/321 Wt (usually seen as one band)
2. 621 Nessy (Uncut)
3. 300/321/621 Het
Build: 2018.02.14 Non-profit supported by the Australian government  |  © Copyright 2018 Australian Phenomics Facility Last updated: 16/02/2018